Monday, March 10, 2008

Cover!!

I'm stickying this so we can continue to enjoy the gorgeousness!! Scroll down for newer posts.

I love, love, LOVE this cover!! I also think I'm having a hot flush. (Fans self.)

43 comments:

Anonymous said...

oh My GOD!!!!! Yeah I'm with you on the hot flash, although I really shouldn't be having those yet, but what the hey!!!
This cover rocks!!! I can't wait to read Dorians story!!

LoL Helen Gonzalez

Anonymous said...

NICE!!!!
OMGosh, I feel faint! Woooh~~~~

Yvonne Lindsay said...

mmmmm, makes you just want to stroke him...

Maree Anderson said...

Yummy! I'm with Yvonne: he's just so darn touchable.... sigh! Congrats to your publisher for another goooooorgeous cover :-)

Maree

Christine said...

SIZZLING! I think this is your hottest cover, yet, Nalini!

(I say that every time, don't I? lol)

Kimberly said...

OMG...................

Dorian..........

So f***ing HOT!!!!

Kat <--attempting not to drool or faint

Casee said...

That makes me want to read it even more. I didn't know that was possible. LOL

Love it!

Anonymous said...

O.M.G!!!!!!!!!!!! I think I need to lie down....I feel all light-headed. Nalini what are you trying to do to us? Whatever it is, PLEASE feel free to continue!

I love the cover!

GULP! How am I meant to get work done when that's all my brain can focus on...

orannia

PS Thank you so much for the chat transcript! Ohhhh, lots of interesting titbits :)

Jane Beckenham said...

Yep, it does it for me, Nalini
One hot guy. Very yummy.

Jane Beckenham
www.janebeckenham.com

Barbarita V said...

Great cover

Anonymous said...

yeah...dorian, wow. your torso definitely has character, like it's winking at me. beckoning me...

LesleyW said...

Love the cover. :)

Anonymous said...

I'm so bad, I keep coming back to stare at the cover when I should be working. Or, more precisely, I shouldn't be looking at "that" during break, cuz I'm not focusing on work anymore...

bel_78 said...

GGGGGGUUUUUUUUAAAAAAAUUUUU :) It rocks :)

Anonymous said...

Gorgeous cover!

Lately I've been seeing lots of great covers, but all of yours have been really most excellent.

How long 'till this one comes out, again?????

Anonymous said...

Wow! That's just insanely hot! I think that's my favorite cover from the series yet! ::faints::

Shaymless Aymless said...

Totally hot cover! *fans self* Makes me want to take him home and pet him for hours!

Ashley said...

Wow!! I LOVE this cover!

Anonymous said...

Nalini,
greetings!
Oh my gosh this cover is delicious; well Dorian is delicious.
ISITSEPTEMBERYET!!!!

Thanks for sharing.
I love Dorian.
Stephanie

limecello said...

oh my gosh - look at those abs O_o they're... wow.

danetteb said...

Yummy...Is that a beach I see in the background? Future water scene ;) ;)

Hugs, Danette

ShellBell said...

totally YUMMY!

Anna said...

OMG what a lush cover!!! Can't wait to get my hands on it. :D

Anonymous said...

Nalini.....OMG Yummy Yummy.... I want I want I want *BG*

Ciao

Anita B

Anonymous said...

That's really great, hot and sexy and it makes me wonder what's in the book... I can't wait for his story!

Saskia Walker said...

Yum! Me like. :)

Kati said...

Sweet! Bring HIM on!

Sweet said...

I lOVE the claw marks on the shoulder. I really want this book :)

Anonymous said...

Oh my, i think i'm in heaven.

And i have to wait til September to get my hands on this book???? *tears hair out in frustration*

Gorgeous cover! Utterly delicious!

Jennifer K. said...

Ooooh, I want it! Now! Love the abs. *swoon*

Jennifer K.

Amanda Ashby said...

Oh, sweet lord. It just gets better and better!!! Oh, and once I finally dragged my eyes away from those abs, I noticed something else that looked pretty good as well - your new USA Today bestseller status!!

Anonymous said...

OMG!! That is sexiness on a stick! Mmmmm....~drools~ Love the cover!!

KT Grant said...

ABS and scratch marks!!
So, who left the marks?
Hot hot cover Nalini :)

:Candice: said...

Look I'm not trying to be a downer but this is the 4th keyboard ruined by drool. Come on Nalini give a girl a break ;)

yummmmmm

Anonymous said...

katie(babs), yes I noticed the scratches too! is it September yet????? me want, me want, me want!!!

Bridget Locke said...

Nalini-You are the luckiest woman out there, honestly! :) You've got some of the hottest covers I've ever seen. I hope when I get published I get your cover people. :D

Excuse me while I wipe up my drool. ;)

MelissaR said...

WOW! This is my first time blogging but I just had to say....I LOVE THIS COVER, THIS SERIES AND CAN'T WAIT TO READ DORIAN'S STORY!

Gail Dayton said...

fabulous cover, Nalini! When's it coming out, again? Need to put a sticker on my calendar so I know when to go get it. :)

G

Anonymous said...

Thank you for sticking this!

*smiling foolishly at the screen*

Prue said...

Yay! I love it. So looking forward to getting this one :D

Anonymous said...

Okay, so I'm a tad bit late with the cover love, but dang, that is a great one.

Anonymous said...

Cool! I totally love it!

Ilona said...

Nalini,

A warning would have been nice. Like EXTREME HOTNESS, GRAB ICE BUCKET AND A HANKIE

Post a Comment