I'm stickying this so we can continue to enjoy the gorgeousness!! Scroll down for newer posts.
I love, love, LOVE this cover!! I also think I'm having a hot flush. (Fans self.)
43 comments
:
Anonymous
said...
oh My GOD!!!!! Yeah I'm with you on the hot flash, although I really shouldn't be having those yet, but what the hey!!! This cover rocks!!! I can't wait to read Dorians story!!
O.M.G!!!!!!!!!!!! I think I need to lie down....I feel all light-headed. Nalini what are you trying to do to us? Whatever it is, PLEASE feel free to continue!
I love the cover!
GULP! How am I meant to get work done when that's all my brain can focus on...
orannia
PS Thank you so much for the chat transcript! Ohhhh, lots of interesting titbits :)
I'm so bad, I keep coming back to stare at the cover when I should be working. Or, more precisely, I shouldn't be looking at "that" during break, cuz I'm not focusing on work anymore...
Oh, sweet lord. It just gets better and better!!! Oh, and once I finally dragged my eyes away from those abs, I noticed something else that looked pretty good as well - your new USA Today bestseller status!!
Nalini-You are the luckiest woman out there, honestly! :) You've got some of the hottest covers I've ever seen. I hope when I get published I get your cover people. :D
I love, love, LOVE this cover!! I also think I'm having a hot flush. (Fans self.)
43 comments :
oh My GOD!!!!! Yeah I'm with you on the hot flash, although I really shouldn't be having those yet, but what the hey!!!
This cover rocks!!! I can't wait to read Dorians story!!
LoL Helen Gonzalez
NICE!!!!
OMGosh, I feel faint! Woooh~~~~
mmmmm, makes you just want to stroke him...
Yummy! I'm with Yvonne: he's just so darn touchable.... sigh! Congrats to your publisher for another goooooorgeous cover :-)
Maree
SIZZLING! I think this is your hottest cover, yet, Nalini!
(I say that every time, don't I? lol)
OMG...................
Dorian..........
So f***ing HOT!!!!
Kat <--attempting not to drool or faint
That makes me want to read it even more. I didn't know that was possible. LOL
Love it!
O.M.G!!!!!!!!!!!! I think I need to lie down....I feel all light-headed. Nalini what are you trying to do to us? Whatever it is, PLEASE feel free to continue!
I love the cover!
GULP! How am I meant to get work done when that's all my brain can focus on...
orannia
PS Thank you so much for the chat transcript! Ohhhh, lots of interesting titbits :)
Yep, it does it for me, Nalini
One hot guy. Very yummy.
Jane Beckenham
www.janebeckenham.com
Great cover
yeah...dorian, wow. your torso definitely has character, like it's winking at me. beckoning me...
Love the cover. :)
I'm so bad, I keep coming back to stare at the cover when I should be working. Or, more precisely, I shouldn't be looking at "that" during break, cuz I'm not focusing on work anymore...
GGGGGGUUUUUUUUAAAAAAAUUUUU :) It rocks :)
Gorgeous cover!
Lately I've been seeing lots of great covers, but all of yours have been really most excellent.
How long 'till this one comes out, again?????
Wow! That's just insanely hot! I think that's my favorite cover from the series yet! ::faints::
Totally hot cover! *fans self* Makes me want to take him home and pet him for hours!
Wow!! I LOVE this cover!
Nalini,
greetings!
Oh my gosh this cover is delicious; well Dorian is delicious.
ISITSEPTEMBERYET!!!!
Thanks for sharing.
I love Dorian.
Stephanie
oh my gosh - look at those abs O_o they're... wow.
Yummy...Is that a beach I see in the background? Future water scene ;) ;)
Hugs, Danette
totally YUMMY!
OMG what a lush cover!!! Can't wait to get my hands on it. :D
Nalini.....OMG Yummy Yummy.... I want I want I want *BG*
Ciao
Anita B
That's really great, hot and sexy and it makes me wonder what's in the book... I can't wait for his story!
Yum! Me like. :)
Sweet! Bring HIM on!
I lOVE the claw marks on the shoulder. I really want this book :)
Oh my, i think i'm in heaven.
And i have to wait til September to get my hands on this book???? *tears hair out in frustration*
Gorgeous cover! Utterly delicious!
Ooooh, I want it! Now! Love the abs. *swoon*
Jennifer K.
Oh, sweet lord. It just gets better and better!!! Oh, and once I finally dragged my eyes away from those abs, I noticed something else that looked pretty good as well - your new USA Today bestseller status!!
OMG!! That is sexiness on a stick! Mmmmm....~drools~ Love the cover!!
ABS and scratch marks!!
So, who left the marks?
Hot hot cover Nalini :)
Look I'm not trying to be a downer but this is the 4th keyboard ruined by drool. Come on Nalini give a girl a break ;)
yummmmmm
katie(babs), yes I noticed the scratches too! is it September yet????? me want, me want, me want!!!
Nalini-You are the luckiest woman out there, honestly! :) You've got some of the hottest covers I've ever seen. I hope when I get published I get your cover people. :D
Excuse me while I wipe up my drool. ;)
WOW! This is my first time blogging but I just had to say....I LOVE THIS COVER, THIS SERIES AND CAN'T WAIT TO READ DORIAN'S STORY!
fabulous cover, Nalini! When's it coming out, again? Need to put a sticker on my calendar so I know when to go get it. :)
G
Thank you for sticking this!
*smiling foolishly at the screen*
Yay! I love it. So looking forward to getting this one :D
Okay, so I'm a tad bit late with the cover love, but dang, that is a great one.
Cool! I totally love it!
Nalini,
A warning would have been nice. Like EXTREME HOTNESS, GRAB ICE BUCKET AND A HANKIE
Post a Comment